Review



analytical software  (Bio-Rad)


Bioz Verified Symbol Bio-Rad is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99

    Structured Review

    Bio-Rad analytical software
    Analytical Software, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 4558 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/analytics+software/Bio-Plex+Manager+Software/pm41777153-210-7-12
    Average 99 stars, based on 4558 article reviews
    analytical software - by Bioz Stars, 2026-09
    99/100 stars

    Images

    Related Articles

    other:

    Article Title: Integrative clinical and preclinical studies identify FerroTerminator1 as a potent therapeutic drug for MASH.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER IBM SPSS software IBM corporation Version 26.0; https://www. ibm.com/ analytics/spssstatistics-software Image Lab Bio-Rad https://www.bio-rad.com/ en-us/product/image-labsoftware?ID=KRE6P5E8Z Other MCD Trophic TP3005 HFHC Trophic TP26304-200 WD Teklad diets TD.

    Article Title: Anillin forms linear structures and facilitates furrow ingression after septin and formin depletion
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER LAS X 3.5.7.23225 Leica https://www.leica-microsystems.com/ products/microscope-software/ p/leica-las-x-ls/ Andor iQ3 Oxford Instruments https://andor.oxinst.com/ Fiji (ImageJ) 1.54 Schindelin et al.116 https://imagej.nih.gov/ij/ Prism 9 GraphPad https://www.graphpad.com/ Image Lab v. 5.2.1 Bio-Rad http://www.bio-rad.com/ MS Excel Microsoft https://www.microsoft.com/ KNIME Analytics Platform 4.6.3 KNIME https://www.knime.com/ Article ll OPEN ACCESS

    Software:

    Article Title: Metabolism-Based Molecular Subtyping Endows Effective Ketogenic Therapy in p53-Mutant Colon Cancer.
    Article Snippet: .. Publicly available transcriptomic datasets from colon cancer patients GEO database GSE17536 GSE17537 GSE39582 Publicly available transcriptomic datasets from colon cancer tissue TCGA database https://cancergenome.nih.gov/ Experimental models: cell lines Human:HT29 Procell Life Sci Tech N/A Human:SW480 Procell Life Sci Tech N/A Human:SW620 Procell Life Sci Tech N/A Software and algorithms Graphpad Prism 8 GraphPad https://www.graphpad.com/scientific-software/prism/ SPSS statistics 19.0 IBM Corporation https://www.ibm.com/analytics/spss-statistics-software/ CytExpert Beckman Coulter https://www.beckmancoulter.cn/ Image Lab Bio-Rad https://www.bio-rad.com/ Oligonucleotides Source Cat no. shRNA1 targeting sequence: OXCT1 GCCAATGCAGCAGATCGCAAATCTCGAGATTTGCGATCTGCTGCATTGGTTTTT Gene Create N/A shRNA2 targeting sequence: OXCT1 GCCTGGTACAAGGGATGTGTTTCTCGAGAAACACATCCCTTGTACCAGGTTTTT Gene Create N/A shRNA3 targeting sequence: OXCT1 GACCGAGCAGGAAACGTGATTTCTCGAGAAATCACGTTTCCTGCTCGGTTTTTT Gene Create N/A p53 primer-ex2 (439 bp) 2F: TCAGACACTGGCATGGTGTTG; 2R: ATGGAATTTTCGCTTCCCAC Taihe Biotech N/A p53 primer-ex3-4 (536 bp) 3F: ACTTTCTGCTCTTGTCTTTCAG; 4R: AGCCAAAGGGTGAAGAGGAATC Taihe Biotech N/A p53 primer-ex5-6 (590 bp) 5F: AGGAGGTGCTTACGCATGTTTG; 6R: AGGGAGGTCAAATAAGCAGCAG Taihe Biotech N/A p53 primer-ex7 (304 bp) 7F: AGGAGGTGCTTACGCATGTTTG; 7R: AGGGAGGTCAAATAAGCAGCAG Taihe Biotech N/A p53 primer-ex8-9 (491 bp) 8F: AGGAGGTGCTTACGCATGTTTG; 9R: AGGGAGGTCAAATAAGCAGCAG Taihe Biotech N/A p53 primer-ex10 (315 bp) 10F: GCATGTTGCTTTTGTACCGTC; 10R: AGCTGCCTTTGACCATGAAG Taihe Biotech N/A (Continued) Adv. ..

    Article Title: Inter-organ insulin-leptin signal crosstalk from the liver enhances survival during food shortages.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Perchloric acid NACALAI TESQUE Cat#26503-75 Recombinant mouse leptin protein R&D Systems Cat#498-OB 4% paraformaldehyde phosphate buffer solution FUJIFILM Wako Pure Chemical Corporation Cat#163-20145 Phosphate buffered saline powder FUJIFILM Wako Pure Chemical Corporation Cat#162-19321 Tissue-Tek O.C.T. compound Sakura Finetek Cat#4583 Sucrose NACALAI TESQUE Cat#30403-55 Tween 20 Merck Cat#P7949 Histofine SAB-PO(R) kit Nichirei Biosciences Cat#426042 3,30-diaminobenzidine tetrahydrochloride (DAB) FUJIFILM Wako Pure Chemical Corporation Cat#349-00903 T7 RNA polymerase Agilent Technologies Cat#600123 Liver perfusion medium Thermo Fisher Scientific Cat#17701038 HEPES Merck Cat#H4034 Collagenase from clostridium histolyticum Merck Cat#C5138 Dulbecco’s modified Eagle’s medium Merck Cat#D5796 Percoll Merck Cat#GE17-0891-01 Wortmannin FUJIFILM Wako Pure Chemical Corporation Cat#230-02341 Dimethyl sulfoxide Kanto chemical Cat#10378-01 Novolin R Novo Nordisk N/A Critical commercial assays RNeasy Mini Kit QIAGEN Cat#74104 RNeasy Micro Kit QIAGEN Cat#74004 ReverTra Ace qPCR RT Master Mix Toyobo Cat#Fsq-301 Bio-Rad Protein Assay Dye Reagent Concentrate Bio-Rad Cat#5000006 PierceTM ECL Plus Western Blotting Substrate Thermo Fisher Scientific Cat#32132 Glycogen Assay Kit Bio Vision Cat#K646-100 DIACOLOR , LIQUID TG-S Toyobo Cat#KTTG-112 Transaminase CII-B Test Wako FUJIFILM Wako Pure Chemical Corporation Cat#431-30901 Mouse/Rat Insulin ELISA Kit Morinaga Institute of Biological Science Cat#M1108 Mouse/Rat Leptin ELISA Kit Morinaga Institute of Biological Science Cat#M1305 Mouse Leptin R DuoSet ELISA R&D Systems Cat#DY497 RecoverAllTM Total Nucleic Acid Isolation Kit for FFPE Thermo Fisher Scientific Cat#AM1975 High-Capacity cDNA Reverse Transcription Kit Thermo Fisher Scientific Cat#4368814 Human Leptin R Quantikine ELISA Kit R&D Systems Cat#DOBR00 Deposited data Western blot images This paper Mendeley Data: https://doi.org/ 10.17632/mz3686btyp.1 Mircoarray data This paper Mendeley Data: https://doi.org/ 10.17632/mz3686btyp.1 Experimental models: Organisms/strains Mouse: C57BL/6J CLEA Japan N/A Mouse: IRloxP /loxP: B6.129S4(FVB)-Insrtm1Khn/J Jackson Laboratory JAX stock #006955 Mouse: LepRloxP /loxP: B6.129P2-Leprtm1Rck/J Jackson Laboratory JAX stock #008327 Mouse: SA-CreERT2+/ mice Schuler et al.31 N/A (Continued on next page) Cell Reports 42, 112415, May 30, 2023 15 .. REAGENT or RESOURCE SOURCE IDENTIFIER Oligonucleotides See Table S4 for primers used in qRT-PCR experiments This paper N/A Software and algorithms Light Cycler Software 4.1.1.21 Roche https://diagnostics.roche.com/ ChemiDoc Touch Imaging System 2.3.0.07 Bio-Rad https://www.bio-rad.com/ Keyence BZ Analyzer 1.1.1.1 Keyence https://www.keyence.com/ LaTheta 3.22 Hitachi https://www.hitachi.com/ MMS-2 5.0 Muromachi Kikai https://muromachi.com/en/ Feature Extraction Software 10.7.3.1 Agilent Technologies https://www.agilent.com/ Ponemah Software 6.30 Data Sciences International https://www.datasci.com/ Ekuseru-Toukei 2015 1.11 Social Survey Research Information Co. https://www.ssri.com/e/ Graphpad Prism 9.5.1 Graphpad https://www.graphpad.com/ ..

    Sequencing:

    Article Title: Metabolism-Based Molecular Subtyping Endows Effective Ketogenic Therapy in p53-Mutant Colon Cancer.
    Article Snippet: .. Publicly available transcriptomic datasets from colon cancer patients GEO database GSE17536 GSE17537 GSE39582 Publicly available transcriptomic datasets from colon cancer tissue TCGA database https://cancergenome.nih.gov/ Experimental models: cell lines Human:HT29 Procell Life Sci Tech N/A Human:SW480 Procell Life Sci Tech N/A Human:SW620 Procell Life Sci Tech N/A Software and algorithms Graphpad Prism 8 GraphPad https://www.graphpad.com/scientific-software/prism/ SPSS statistics 19.0 IBM Corporation https://www.ibm.com/analytics/spss-statistics-software/ CytExpert Beckman Coulter https://www.beckmancoulter.cn/ Image Lab Bio-Rad https://www.bio-rad.com/ Oligonucleotides Source Cat no. shRNA1 targeting sequence: OXCT1 GCCAATGCAGCAGATCGCAAATCTCGAGATTTGCGATCTGCTGCATTGGTTTTT Gene Create N/A shRNA2 targeting sequence: OXCT1 GCCTGGTACAAGGGATGTGTTTCTCGAGAAACACATCCCTTGTACCAGGTTTTT Gene Create N/A shRNA3 targeting sequence: OXCT1 GACCGAGCAGGAAACGTGATTTCTCGAGAAATCACGTTTCCTGCTCGGTTTTTT Gene Create N/A p53 primer-ex2 (439 bp) 2F: TCAGACACTGGCATGGTGTTG; 2R: ATGGAATTTTCGCTTCCCAC Taihe Biotech N/A p53 primer-ex3-4 (536 bp) 3F: ACTTTCTGCTCTTGTCTTTCAG; 4R: AGCCAAAGGGTGAAGAGGAATC Taihe Biotech N/A p53 primer-ex5-6 (590 bp) 5F: AGGAGGTGCTTACGCATGTTTG; 6R: AGGGAGGTCAAATAAGCAGCAG Taihe Biotech N/A p53 primer-ex7 (304 bp) 7F: AGGAGGTGCTTACGCATGTTTG; 7R: AGGGAGGTCAAATAAGCAGCAG Taihe Biotech N/A p53 primer-ex8-9 (491 bp) 8F: AGGAGGTGCTTACGCATGTTTG; 9R: AGGGAGGTCAAATAAGCAGCAG Taihe Biotech N/A p53 primer-ex10 (315 bp) 10F: GCATGTTGCTTTTGTACCGTC; 10R: AGCTGCCTTTGACCATGAAG Taihe Biotech N/A (Continued) Adv. ..

    Article Title: miR-708-5p is elevated in bipolar patients and can induce mood disorder-associated behavior in mice.
    Article Snippet: .. Reagents and tools table Reagent/Resource Reference or Source Identifier or Catalog Number Experimental models C57BL/6 mice Janvier Laboratories (France) Mus musculus Primary hippocampal and cortical neurons from embryonic rats Janvier Laboratories (France) Rattus norvegicus Human PBMCs This manuscript Homo sapiens Recombinant DNA rAAV-hSyn-EGFP Addgene #114213 pmirGLO dual‐luciferase expression vector Promega E1330 Oligonucleotides and other sequence-based reagents miR-708-5p Taqman qPCR probe ThermoFisher 4427975 miR-16-5p Taqman qPCR probe ThermoFisher 4427975 miR-30a-5p Taqman qPCR probe ThermoFisher 4427975 miR-1248-5p Taqman qPCR probe ThermoFisher 4427975 miR-129-5p Taqman qPCR probe ThermoFisher 4427975 U6 snRNA Taqman qPCR probe ThermoFisher 4427975/001973 For primers used for cloning, see Appendix Table S2 This paper N/A Chemicals, Enzymes and other reagents TRIzol TM Reagent Thermo Fisher 15596026 Glycogen Ambion AM9510 Software Prism 10 GraphPad https://www.graphpad.com Reagent/Resource Reference or Source Identifier or Catalog Number Zen Microscopy Software Zeiss https://www.zeiss.com/ microscopy/en/products/ software/zeiss-zen.html edgeR Bioconductor http://bioconductor.org/ packages/edgeR/ Fiji ImageJ NIH https://imagej.net/ Inkscape Inkscape https://inkscape.org/ Image Lab 6 Bio-Rad http://www.bio-rad.com/enus/sku/1709690-image-labsoftware CFX Maestro Bio-Rad https://www.bio-rad.com/ench/product/cfx-maestrosoftware-for-cfx-real-time-pcrinstruments Endnote 21 Clarivate Analytics http://endnote.com Other Lipofectamine 2000 Thermo Fisher 11668019 LeukoLOCK Thermo Fisher AM1923 mirVanaTM Thermo Fisher AM1560 QuantiGene ViewRNA miRNA Cell Assay Kit Thermo Fisher QVCM0001 Phusion Hot Start Polymerase Thermo Fisher F549S Tissue-Tek O.C.T Compound Sakura Finetek Europe 4583 Aqua Poly Mount Chemie Brunschwig POL18606-20 Complete Protease Inhibitor Cocktail EDTAfree SigmaAldrich P8340 4x Laemmli Sample Buffer Bio-Rad 1610747 Mini-PROTEAN® TGXTM Precast Protein Gel Bio-Rad 4561094 ClarityTM Western ECL Substrate Bio-Rad 1705060 14 EMBO reports © The Author(s) D ow nloaded from https://w w w .em bopress.org on M arch 18, 2025 from IP 2400:1a00:b030:f63:a41d:1434:c4fe:173b. .. Reagent/Resource Reference or Source Identifier or Catalog Number TURBO DNase enzyme Thermo Fisher AM2238 iScript cDNA synthesis kit Bio-Rad 1708891 iTaq Universal SYBR Green Supermix Bio-Rad 1725121 TaqMan MicroRNA Reverse Transcription Kit Thermo Fisher 4366597 TaqMan Universal PCR Master Mix Thermo Fisher 4304437 MidiPrep Kit Macherey Nagel 740410 Passive lysis buffer (luciferase) Promega E194A Aqua-Poly/Mount Chemie Brunschwig POL18606-20 Trans-Blot Turbo system Bio-Rad 1704158 ClarityTM Western ECL Substrate Bio-Rad 1705060 DEPC Nuclease-free H2O Ambion AM9906

    Quantitative RT-PCR:

    Article Title: Inter-organ insulin-leptin signal crosstalk from the liver enhances survival during food shortages.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Perchloric acid NACALAI TESQUE Cat#26503-75 Recombinant mouse leptin protein R&D Systems Cat#498-OB 4% paraformaldehyde phosphate buffer solution FUJIFILM Wako Pure Chemical Corporation Cat#163-20145 Phosphate buffered saline powder FUJIFILM Wako Pure Chemical Corporation Cat#162-19321 Tissue-Tek O.C.T. compound Sakura Finetek Cat#4583 Sucrose NACALAI TESQUE Cat#30403-55 Tween 20 Merck Cat#P7949 Histofine SAB-PO(R) kit Nichirei Biosciences Cat#426042 3,30-diaminobenzidine tetrahydrochloride (DAB) FUJIFILM Wako Pure Chemical Corporation Cat#349-00903 T7 RNA polymerase Agilent Technologies Cat#600123 Liver perfusion medium Thermo Fisher Scientific Cat#17701038 HEPES Merck Cat#H4034 Collagenase from clostridium histolyticum Merck Cat#C5138 Dulbecco’s modified Eagle’s medium Merck Cat#D5796 Percoll Merck Cat#GE17-0891-01 Wortmannin FUJIFILM Wako Pure Chemical Corporation Cat#230-02341 Dimethyl sulfoxide Kanto chemical Cat#10378-01 Novolin R Novo Nordisk N/A Critical commercial assays RNeasy Mini Kit QIAGEN Cat#74104 RNeasy Micro Kit QIAGEN Cat#74004 ReverTra Ace qPCR RT Master Mix Toyobo Cat#Fsq-301 Bio-Rad Protein Assay Dye Reagent Concentrate Bio-Rad Cat#5000006 PierceTM ECL Plus Western Blotting Substrate Thermo Fisher Scientific Cat#32132 Glycogen Assay Kit Bio Vision Cat#K646-100 DIACOLOR , LIQUID TG-S Toyobo Cat#KTTG-112 Transaminase CII-B Test Wako FUJIFILM Wako Pure Chemical Corporation Cat#431-30901 Mouse/Rat Insulin ELISA Kit Morinaga Institute of Biological Science Cat#M1108 Mouse/Rat Leptin ELISA Kit Morinaga Institute of Biological Science Cat#M1305 Mouse Leptin R DuoSet ELISA R&D Systems Cat#DY497 RecoverAllTM Total Nucleic Acid Isolation Kit for FFPE Thermo Fisher Scientific Cat#AM1975 High-Capacity cDNA Reverse Transcription Kit Thermo Fisher Scientific Cat#4368814 Human Leptin R Quantikine ELISA Kit R&D Systems Cat#DOBR00 Deposited data Western blot images This paper Mendeley Data: https://doi.org/ 10.17632/mz3686btyp.1 Mircoarray data This paper Mendeley Data: https://doi.org/ 10.17632/mz3686btyp.1 Experimental models: Organisms/strains Mouse: C57BL/6J CLEA Japan N/A Mouse: IRloxP /loxP: B6.129S4(FVB)-Insrtm1Khn/J Jackson Laboratory JAX stock #006955 Mouse: LepRloxP /loxP: B6.129P2-Leprtm1Rck/J Jackson Laboratory JAX stock #008327 Mouse: SA-CreERT2+/ mice Schuler et al.31 N/A (Continued on next page) Cell Reports 42, 112415, May 30, 2023 15 .. REAGENT or RESOURCE SOURCE IDENTIFIER Oligonucleotides See Table S4 for primers used in qRT-PCR experiments This paper N/A Software and algorithms Light Cycler Software 4.1.1.21 Roche https://diagnostics.roche.com/ ChemiDoc Touch Imaging System 2.3.0.07 Bio-Rad https://www.bio-rad.com/ Keyence BZ Analyzer 1.1.1.1 Keyence https://www.keyence.com/ LaTheta 3.22 Hitachi https://www.hitachi.com/ MMS-2 5.0 Muromachi Kikai https://muromachi.com/en/ Feature Extraction Software 10.7.3.1 Agilent Technologies https://www.agilent.com/ Ponemah Software 6.30 Data Sciences International https://www.datasci.com/ Ekuseru-Toukei 2015 1.11 Social Survey Research Information Co. https://www.ssri.com/e/ Graphpad Prism 9.5.1 Graphpad https://www.graphpad.com/ ..

    Imaging:

    Article Title: Inter-organ insulin-leptin signal crosstalk from the liver enhances survival during food shortages.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Perchloric acid NACALAI TESQUE Cat#26503-75 Recombinant mouse leptin protein R&D Systems Cat#498-OB 4% paraformaldehyde phosphate buffer solution FUJIFILM Wako Pure Chemical Corporation Cat#163-20145 Phosphate buffered saline powder FUJIFILM Wako Pure Chemical Corporation Cat#162-19321 Tissue-Tek O.C.T. compound Sakura Finetek Cat#4583 Sucrose NACALAI TESQUE Cat#30403-55 Tween 20 Merck Cat#P7949 Histofine SAB-PO(R) kit Nichirei Biosciences Cat#426042 3,30-diaminobenzidine tetrahydrochloride (DAB) FUJIFILM Wako Pure Chemical Corporation Cat#349-00903 T7 RNA polymerase Agilent Technologies Cat#600123 Liver perfusion medium Thermo Fisher Scientific Cat#17701038 HEPES Merck Cat#H4034 Collagenase from clostridium histolyticum Merck Cat#C5138 Dulbecco’s modified Eagle’s medium Merck Cat#D5796 Percoll Merck Cat#GE17-0891-01 Wortmannin FUJIFILM Wako Pure Chemical Corporation Cat#230-02341 Dimethyl sulfoxide Kanto chemical Cat#10378-01 Novolin R Novo Nordisk N/A Critical commercial assays RNeasy Mini Kit QIAGEN Cat#74104 RNeasy Micro Kit QIAGEN Cat#74004 ReverTra Ace qPCR RT Master Mix Toyobo Cat#Fsq-301 Bio-Rad Protein Assay Dye Reagent Concentrate Bio-Rad Cat#5000006 PierceTM ECL Plus Western Blotting Substrate Thermo Fisher Scientific Cat#32132 Glycogen Assay Kit Bio Vision Cat#K646-100 DIACOLOR , LIQUID TG-S Toyobo Cat#KTTG-112 Transaminase CII-B Test Wako FUJIFILM Wako Pure Chemical Corporation Cat#431-30901 Mouse/Rat Insulin ELISA Kit Morinaga Institute of Biological Science Cat#M1108 Mouse/Rat Leptin ELISA Kit Morinaga Institute of Biological Science Cat#M1305 Mouse Leptin R DuoSet ELISA R&D Systems Cat#DY497 RecoverAllTM Total Nucleic Acid Isolation Kit for FFPE Thermo Fisher Scientific Cat#AM1975 High-Capacity cDNA Reverse Transcription Kit Thermo Fisher Scientific Cat#4368814 Human Leptin R Quantikine ELISA Kit R&D Systems Cat#DOBR00 Deposited data Western blot images This paper Mendeley Data: https://doi.org/ 10.17632/mz3686btyp.1 Mircoarray data This paper Mendeley Data: https://doi.org/ 10.17632/mz3686btyp.1 Experimental models: Organisms/strains Mouse: C57BL/6J CLEA Japan N/A Mouse: IRloxP /loxP: B6.129S4(FVB)-Insrtm1Khn/J Jackson Laboratory JAX stock #006955 Mouse: LepRloxP /loxP: B6.129P2-Leprtm1Rck/J Jackson Laboratory JAX stock #008327 Mouse: SA-CreERT2+/ mice Schuler et al.31 N/A (Continued on next page) Cell Reports 42, 112415, May 30, 2023 15 .. REAGENT or RESOURCE SOURCE IDENTIFIER Oligonucleotides See Table S4 for primers used in qRT-PCR experiments This paper N/A Software and algorithms Light Cycler Software 4.1.1.21 Roche https://diagnostics.roche.com/ ChemiDoc Touch Imaging System 2.3.0.07 Bio-Rad https://www.bio-rad.com/ Keyence BZ Analyzer 1.1.1.1 Keyence https://www.keyence.com/ LaTheta 3.22 Hitachi https://www.hitachi.com/ MMS-2 5.0 Muromachi Kikai https://muromachi.com/en/ Feature Extraction Software 10.7.3.1 Agilent Technologies https://www.agilent.com/ Ponemah Software 6.30 Data Sciences International https://www.datasci.com/ Ekuseru-Toukei 2015 1.11 Social Survey Research Information Co. https://www.ssri.com/e/ Graphpad Prism 9.5.1 Graphpad https://www.graphpad.com/ ..

    Extraction:

    Article Title: Inter-organ insulin-leptin signal crosstalk from the liver enhances survival during food shortages.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Perchloric acid NACALAI TESQUE Cat#26503-75 Recombinant mouse leptin protein R&D Systems Cat#498-OB 4% paraformaldehyde phosphate buffer solution FUJIFILM Wako Pure Chemical Corporation Cat#163-20145 Phosphate buffered saline powder FUJIFILM Wako Pure Chemical Corporation Cat#162-19321 Tissue-Tek O.C.T. compound Sakura Finetek Cat#4583 Sucrose NACALAI TESQUE Cat#30403-55 Tween 20 Merck Cat#P7949 Histofine SAB-PO(R) kit Nichirei Biosciences Cat#426042 3,30-diaminobenzidine tetrahydrochloride (DAB) FUJIFILM Wako Pure Chemical Corporation Cat#349-00903 T7 RNA polymerase Agilent Technologies Cat#600123 Liver perfusion medium Thermo Fisher Scientific Cat#17701038 HEPES Merck Cat#H4034 Collagenase from clostridium histolyticum Merck Cat#C5138 Dulbecco’s modified Eagle’s medium Merck Cat#D5796 Percoll Merck Cat#GE17-0891-01 Wortmannin FUJIFILM Wako Pure Chemical Corporation Cat#230-02341 Dimethyl sulfoxide Kanto chemical Cat#10378-01 Novolin R Novo Nordisk N/A Critical commercial assays RNeasy Mini Kit QIAGEN Cat#74104 RNeasy Micro Kit QIAGEN Cat#74004 ReverTra Ace qPCR RT Master Mix Toyobo Cat#Fsq-301 Bio-Rad Protein Assay Dye Reagent Concentrate Bio-Rad Cat#5000006 PierceTM ECL Plus Western Blotting Substrate Thermo Fisher Scientific Cat#32132 Glycogen Assay Kit Bio Vision Cat#K646-100 DIACOLOR , LIQUID TG-S Toyobo Cat#KTTG-112 Transaminase CII-B Test Wako FUJIFILM Wako Pure Chemical Corporation Cat#431-30901 Mouse/Rat Insulin ELISA Kit Morinaga Institute of Biological Science Cat#M1108 Mouse/Rat Leptin ELISA Kit Morinaga Institute of Biological Science Cat#M1305 Mouse Leptin R DuoSet ELISA R&D Systems Cat#DY497 RecoverAllTM Total Nucleic Acid Isolation Kit for FFPE Thermo Fisher Scientific Cat#AM1975 High-Capacity cDNA Reverse Transcription Kit Thermo Fisher Scientific Cat#4368814 Human Leptin R Quantikine ELISA Kit R&D Systems Cat#DOBR00 Deposited data Western blot images This paper Mendeley Data: https://doi.org/ 10.17632/mz3686btyp.1 Mircoarray data This paper Mendeley Data: https://doi.org/ 10.17632/mz3686btyp.1 Experimental models: Organisms/strains Mouse: C57BL/6J CLEA Japan N/A Mouse: IRloxP /loxP: B6.129S4(FVB)-Insrtm1Khn/J Jackson Laboratory JAX stock #006955 Mouse: LepRloxP /loxP: B6.129P2-Leprtm1Rck/J Jackson Laboratory JAX stock #008327 Mouse: SA-CreERT2+/ mice Schuler et al.31 N/A (Continued on next page) Cell Reports 42, 112415, May 30, 2023 15 .. REAGENT or RESOURCE SOURCE IDENTIFIER Oligonucleotides See Table S4 for primers used in qRT-PCR experiments This paper N/A Software and algorithms Light Cycler Software 4.1.1.21 Roche https://diagnostics.roche.com/ ChemiDoc Touch Imaging System 2.3.0.07 Bio-Rad https://www.bio-rad.com/ Keyence BZ Analyzer 1.1.1.1 Keyence https://www.keyence.com/ LaTheta 3.22 Hitachi https://www.hitachi.com/ MMS-2 5.0 Muromachi Kikai https://muromachi.com/en/ Feature Extraction Software 10.7.3.1 Agilent Technologies https://www.agilent.com/ Ponemah Software 6.30 Data Sciences International https://www.datasci.com/ Ekuseru-Toukei 2015 1.11 Social Survey Research Information Co. https://www.ssri.com/e/ Graphpad Prism 9.5.1 Graphpad https://www.graphpad.com/ ..

    Recombinant:

    Article Title: miR-708-5p is elevated in bipolar patients and can induce mood disorder-associated behavior in mice.
    Article Snippet: .. Reagents and tools table Reagent/Resource Reference or Source Identifier or Catalog Number Experimental models C57BL/6 mice Janvier Laboratories (France) Mus musculus Primary hippocampal and cortical neurons from embryonic rats Janvier Laboratories (France) Rattus norvegicus Human PBMCs This manuscript Homo sapiens Recombinant DNA rAAV-hSyn-EGFP Addgene #114213 pmirGLO dual‐luciferase expression vector Promega E1330 Oligonucleotides and other sequence-based reagents miR-708-5p Taqman qPCR probe ThermoFisher 4427975 miR-16-5p Taqman qPCR probe ThermoFisher 4427975 miR-30a-5p Taqman qPCR probe ThermoFisher 4427975 miR-1248-5p Taqman qPCR probe ThermoFisher 4427975 miR-129-5p Taqman qPCR probe ThermoFisher 4427975 U6 snRNA Taqman qPCR probe ThermoFisher 4427975/001973 For primers used for cloning, see Appendix Table S2 This paper N/A Chemicals, Enzymes and other reagents TRIzol TM Reagent Thermo Fisher 15596026 Glycogen Ambion AM9510 Software Prism 10 GraphPad https://www.graphpad.com Reagent/Resource Reference or Source Identifier or Catalog Number Zen Microscopy Software Zeiss https://www.zeiss.com/ microscopy/en/products/ software/zeiss-zen.html edgeR Bioconductor http://bioconductor.org/ packages/edgeR/ Fiji ImageJ NIH https://imagej.net/ Inkscape Inkscape https://inkscape.org/ Image Lab 6 Bio-Rad http://www.bio-rad.com/enus/sku/1709690-image-labsoftware CFX Maestro Bio-Rad https://www.bio-rad.com/ench/product/cfx-maestrosoftware-for-cfx-real-time-pcrinstruments Endnote 21 Clarivate Analytics http://endnote.com Other Lipofectamine 2000 Thermo Fisher 11668019 LeukoLOCK Thermo Fisher AM1923 mirVanaTM Thermo Fisher AM1560 QuantiGene ViewRNA miRNA Cell Assay Kit Thermo Fisher QVCM0001 Phusion Hot Start Polymerase Thermo Fisher F549S Tissue-Tek O.C.T Compound Sakura Finetek Europe 4583 Aqua Poly Mount Chemie Brunschwig POL18606-20 Complete Protease Inhibitor Cocktail EDTAfree SigmaAldrich P8340 4x Laemmli Sample Buffer Bio-Rad 1610747 Mini-PROTEAN® TGXTM Precast Protein Gel Bio-Rad 4561094 ClarityTM Western ECL Substrate Bio-Rad 1705060 14 EMBO reports © The Author(s) D ow nloaded from https://w w w .em bopress.org on M arch 18, 2025 from IP 2400:1a00:b030:f63:a41d:1434:c4fe:173b. .. Reagent/Resource Reference or Source Identifier or Catalog Number TURBO DNase enzyme Thermo Fisher AM2238 iScript cDNA synthesis kit Bio-Rad 1708891 iTaq Universal SYBR Green Supermix Bio-Rad 1725121 TaqMan MicroRNA Reverse Transcription Kit Thermo Fisher 4366597 TaqMan Universal PCR Master Mix Thermo Fisher 4304437 MidiPrep Kit Macherey Nagel 740410 Passive lysis buffer (luciferase) Promega E194A Aqua-Poly/Mount Chemie Brunschwig POL18606-20 Trans-Blot Turbo system Bio-Rad 1704158 ClarityTM Western ECL Substrate Bio-Rad 1705060 DEPC Nuclease-free H2O Ambion AM9906

    Expressing:

    Article Title: miR-708-5p is elevated in bipolar patients and can induce mood disorder-associated behavior in mice.
    Article Snippet: .. Reagents and tools table Reagent/Resource Reference or Source Identifier or Catalog Number Experimental models C57BL/6 mice Janvier Laboratories (France) Mus musculus Primary hippocampal and cortical neurons from embryonic rats Janvier Laboratories (France) Rattus norvegicus Human PBMCs This manuscript Homo sapiens Recombinant DNA rAAV-hSyn-EGFP Addgene #114213 pmirGLO dual‐luciferase expression vector Promega E1330 Oligonucleotides and other sequence-based reagents miR-708-5p Taqman qPCR probe ThermoFisher 4427975 miR-16-5p Taqman qPCR probe ThermoFisher 4427975 miR-30a-5p Taqman qPCR probe ThermoFisher 4427975 miR-1248-5p Taqman qPCR probe ThermoFisher 4427975 miR-129-5p Taqman qPCR probe ThermoFisher 4427975 U6 snRNA Taqman qPCR probe ThermoFisher 4427975/001973 For primers used for cloning, see Appendix Table S2 This paper N/A Chemicals, Enzymes and other reagents TRIzol TM Reagent Thermo Fisher 15596026 Glycogen Ambion AM9510 Software Prism 10 GraphPad https://www.graphpad.com Reagent/Resource Reference or Source Identifier or Catalog Number Zen Microscopy Software Zeiss https://www.zeiss.com/ microscopy/en/products/ software/zeiss-zen.html edgeR Bioconductor http://bioconductor.org/ packages/edgeR/ Fiji ImageJ NIH https://imagej.net/ Inkscape Inkscape https://inkscape.org/ Image Lab 6 Bio-Rad http://www.bio-rad.com/enus/sku/1709690-image-labsoftware CFX Maestro Bio-Rad https://www.bio-rad.com/ench/product/cfx-maestrosoftware-for-cfx-real-time-pcrinstruments Endnote 21 Clarivate Analytics http://endnote.com Other Lipofectamine 2000 Thermo Fisher 11668019 LeukoLOCK Thermo Fisher AM1923 mirVanaTM Thermo Fisher AM1560 QuantiGene ViewRNA miRNA Cell Assay Kit Thermo Fisher QVCM0001 Phusion Hot Start Polymerase Thermo Fisher F549S Tissue-Tek O.C.T Compound Sakura Finetek Europe 4583 Aqua Poly Mount Chemie Brunschwig POL18606-20 Complete Protease Inhibitor Cocktail EDTAfree SigmaAldrich P8340 4x Laemmli Sample Buffer Bio-Rad 1610747 Mini-PROTEAN® TGXTM Precast Protein Gel Bio-Rad 4561094 ClarityTM Western ECL Substrate Bio-Rad 1705060 14 EMBO reports © The Author(s) D ow nloaded from https://w w w .em bopress.org on M arch 18, 2025 from IP 2400:1a00:b030:f63:a41d:1434:c4fe:173b. .. Reagent/Resource Reference or Source Identifier or Catalog Number TURBO DNase enzyme Thermo Fisher AM2238 iScript cDNA synthesis kit Bio-Rad 1708891 iTaq Universal SYBR Green Supermix Bio-Rad 1725121 TaqMan MicroRNA Reverse Transcription Kit Thermo Fisher 4366597 TaqMan Universal PCR Master Mix Thermo Fisher 4304437 MidiPrep Kit Macherey Nagel 740410 Passive lysis buffer (luciferase) Promega E194A Aqua-Poly/Mount Chemie Brunschwig POL18606-20 Trans-Blot Turbo system Bio-Rad 1704158 ClarityTM Western ECL Substrate Bio-Rad 1705060 DEPC Nuclease-free H2O Ambion AM9906

    Plasmid Preparation:

    Article Title: miR-708-5p is elevated in bipolar patients and can induce mood disorder-associated behavior in mice.
    Article Snippet: .. Reagents and tools table Reagent/Resource Reference or Source Identifier or Catalog Number Experimental models C57BL/6 mice Janvier Laboratories (France) Mus musculus Primary hippocampal and cortical neurons from embryonic rats Janvier Laboratories (France) Rattus norvegicus Human PBMCs This manuscript Homo sapiens Recombinant DNA rAAV-hSyn-EGFP Addgene #114213 pmirGLO dual‐luciferase expression vector Promega E1330 Oligonucleotides and other sequence-based reagents miR-708-5p Taqman qPCR probe ThermoFisher 4427975 miR-16-5p Taqman qPCR probe ThermoFisher 4427975 miR-30a-5p Taqman qPCR probe ThermoFisher 4427975 miR-1248-5p Taqman qPCR probe ThermoFisher 4427975 miR-129-5p Taqman qPCR probe ThermoFisher 4427975 U6 snRNA Taqman qPCR probe ThermoFisher 4427975/001973 For primers used for cloning, see Appendix Table S2 This paper N/A Chemicals, Enzymes and other reagents TRIzol TM Reagent Thermo Fisher 15596026 Glycogen Ambion AM9510 Software Prism 10 GraphPad https://www.graphpad.com Reagent/Resource Reference or Source Identifier or Catalog Number Zen Microscopy Software Zeiss https://www.zeiss.com/ microscopy/en/products/ software/zeiss-zen.html edgeR Bioconductor http://bioconductor.org/ packages/edgeR/ Fiji ImageJ NIH https://imagej.net/ Inkscape Inkscape https://inkscape.org/ Image Lab 6 Bio-Rad http://www.bio-rad.com/enus/sku/1709690-image-labsoftware CFX Maestro Bio-Rad https://www.bio-rad.com/ench/product/cfx-maestrosoftware-for-cfx-real-time-pcrinstruments Endnote 21 Clarivate Analytics http://endnote.com Other Lipofectamine 2000 Thermo Fisher 11668019 LeukoLOCK Thermo Fisher AM1923 mirVanaTM Thermo Fisher AM1560 QuantiGene ViewRNA miRNA Cell Assay Kit Thermo Fisher QVCM0001 Phusion Hot Start Polymerase Thermo Fisher F549S Tissue-Tek O.C.T Compound Sakura Finetek Europe 4583 Aqua Poly Mount Chemie Brunschwig POL18606-20 Complete Protease Inhibitor Cocktail EDTAfree SigmaAldrich P8340 4x Laemmli Sample Buffer Bio-Rad 1610747 Mini-PROTEAN® TGXTM Precast Protein Gel Bio-Rad 4561094 ClarityTM Western ECL Substrate Bio-Rad 1705060 14 EMBO reports © The Author(s) D ow nloaded from https://w w w .em bopress.org on M arch 18, 2025 from IP 2400:1a00:b030:f63:a41d:1434:c4fe:173b. .. Reagent/Resource Reference or Source Identifier or Catalog Number TURBO DNase enzyme Thermo Fisher AM2238 iScript cDNA synthesis kit Bio-Rad 1708891 iTaq Universal SYBR Green Supermix Bio-Rad 1725121 TaqMan MicroRNA Reverse Transcription Kit Thermo Fisher 4366597 TaqMan Universal PCR Master Mix Thermo Fisher 4304437 MidiPrep Kit Macherey Nagel 740410 Passive lysis buffer (luciferase) Promega E194A Aqua-Poly/Mount Chemie Brunschwig POL18606-20 Trans-Blot Turbo system Bio-Rad 1704158 ClarityTM Western ECL Substrate Bio-Rad 1705060 DEPC Nuclease-free H2O Ambion AM9906

    Real-time Polymerase Chain Reaction:

    Article Title: miR-708-5p is elevated in bipolar patients and can induce mood disorder-associated behavior in mice.
    Article Snippet: .. Reagents and tools table Reagent/Resource Reference or Source Identifier or Catalog Number Experimental models C57BL/6 mice Janvier Laboratories (France) Mus musculus Primary hippocampal and cortical neurons from embryonic rats Janvier Laboratories (France) Rattus norvegicus Human PBMCs This manuscript Homo sapiens Recombinant DNA rAAV-hSyn-EGFP Addgene #114213 pmirGLO dual‐luciferase expression vector Promega E1330 Oligonucleotides and other sequence-based reagents miR-708-5p Taqman qPCR probe ThermoFisher 4427975 miR-16-5p Taqman qPCR probe ThermoFisher 4427975 miR-30a-5p Taqman qPCR probe ThermoFisher 4427975 miR-1248-5p Taqman qPCR probe ThermoFisher 4427975 miR-129-5p Taqman qPCR probe ThermoFisher 4427975 U6 snRNA Taqman qPCR probe ThermoFisher 4427975/001973 For primers used for cloning, see Appendix Table S2 This paper N/A Chemicals, Enzymes and other reagents TRIzol TM Reagent Thermo Fisher 15596026 Glycogen Ambion AM9510 Software Prism 10 GraphPad https://www.graphpad.com Reagent/Resource Reference or Source Identifier or Catalog Number Zen Microscopy Software Zeiss https://www.zeiss.com/ microscopy/en/products/ software/zeiss-zen.html edgeR Bioconductor http://bioconductor.org/ packages/edgeR/ Fiji ImageJ NIH https://imagej.net/ Inkscape Inkscape https://inkscape.org/ Image Lab 6 Bio-Rad http://www.bio-rad.com/enus/sku/1709690-image-labsoftware CFX Maestro Bio-Rad https://www.bio-rad.com/ench/product/cfx-maestrosoftware-for-cfx-real-time-pcrinstruments Endnote 21 Clarivate Analytics http://endnote.com Other Lipofectamine 2000 Thermo Fisher 11668019 LeukoLOCK Thermo Fisher AM1923 mirVanaTM Thermo Fisher AM1560 QuantiGene ViewRNA miRNA Cell Assay Kit Thermo Fisher QVCM0001 Phusion Hot Start Polymerase Thermo Fisher F549S Tissue-Tek O.C.T Compound Sakura Finetek Europe 4583 Aqua Poly Mount Chemie Brunschwig POL18606-20 Complete Protease Inhibitor Cocktail EDTAfree SigmaAldrich P8340 4x Laemmli Sample Buffer Bio-Rad 1610747 Mini-PROTEAN® TGXTM Precast Protein Gel Bio-Rad 4561094 ClarityTM Western ECL Substrate Bio-Rad 1705060 14 EMBO reports © The Author(s) D ow nloaded from https://w w w .em bopress.org on M arch 18, 2025 from IP 2400:1a00:b030:f63:a41d:1434:c4fe:173b. .. Reagent/Resource Reference or Source Identifier or Catalog Number TURBO DNase enzyme Thermo Fisher AM2238 iScript cDNA synthesis kit Bio-Rad 1708891 iTaq Universal SYBR Green Supermix Bio-Rad 1725121 TaqMan MicroRNA Reverse Transcription Kit Thermo Fisher 4366597 TaqMan Universal PCR Master Mix Thermo Fisher 4304437 MidiPrep Kit Macherey Nagel 740410 Passive lysis buffer (luciferase) Promega E194A Aqua-Poly/Mount Chemie Brunschwig POL18606-20 Trans-Blot Turbo system Bio-Rad 1704158 ClarityTM Western ECL Substrate Bio-Rad 1705060 DEPC Nuclease-free H2O Ambion AM9906



    Similar Products

    90
    Cytel Inc statistical analytic software (carey, north carolina)
    Statistical Analytic Software (Carey, North Carolina), supplied by Cytel Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/analytics+software/statistical+analytic+software++carey++north+carolina+/nct05444361-155-0-19
    Average 90 stars, based on 1 article reviews
    statistical analytic software (carey, north carolina) - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    99
    Malvern Panalytical nta 2 3 analytical software
    Nta 2 3 Analytical Software, supplied by Malvern Panalytical, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/analytics+software/NanoSight+Pro/10__1016_slash_j__jddst__2026__108352-90-19-28
    Average 99 stars, based on 1 article reviews
    nta 2 3 analytical software - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    86
    Geomagic Inc analytic software
    Analytic Software, supplied by Geomagic Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/analytics+software/analytic+software/pmc13136586-24-20-22
    Average 86 stars, based on 1 article reviews
    analytic software - by Bioz Stars, 2026-09
    86/100 stars
      Buy from Supplier

    86
    FUJIFILM VisualSonics Inc vevo 770 analytic software
    Vevo 770 Analytic Software, supplied by FUJIFILM VisualSonics Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/analytics+software/pm41923641-770-7-11
    Average 86 stars, based on 1 article reviews
    vevo 770 analytic software - by Bioz Stars, 2026-09
    86/100 stars
      Buy from Supplier

    99
    Shimadzu Corporation labsolutions insight multi analyte quantitation software
    Labsolutions Insight Multi Analyte Quantitation Software, supplied by Shimadzu Corporation, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/analytics+software/LabSolutions+Series/pmc12987455-145-13-18
    Average 99 stars, based on 1 article reviews
    labsolutions insight multi analyte quantitation software - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    86
    Seca analytics 115 pc software
    Analytics 115 Pc Software, supplied by Seca, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/analytics+software/125+analytics+seca/pmc13021583-125-9-13
    Average 86 stars, based on 1 article reviews
    analytics 115 pc software - by Bioz Stars, 2026-09
    86/100 stars
      Buy from Supplier

    86
    Edwards Lifesciences Inc acumen analytics software
    Acumen Analytics Software, supplied by Edwards Lifesciences Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/analytics+software/acumen+assisted+fluid+management+software/pmc13003691-144-26-29
    Average 86 stars, based on 1 article reviews
    acumen analytics software - by Bioz Stars, 2026-09
    86/100 stars
      Buy from Supplier

    86
    FUJIFILM VisualSonics Inc vevo 2100 analytic software
    Vevo 2100 Analytic Software, supplied by FUJIFILM VisualSonics Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/analytics+software/pmc13002834-64-8-12
    Average 86 stars, based on 1 article reviews
    vevo 2100 analytic software - by Bioz Stars, 2026-09
    86/100 stars
      Buy from Supplier

    99
    Bio-Rad analytical software
    Analytical Software, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/analytics+software/Bio-Plex+Manager+Software/pm41777153-210-7-12
    Average 99 stars, based on 1 article reviews
    analytical software - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    Image Search Results